Introduction
|
Sample preparation
|
First timer's walkthrough
Submission process
|
Troubleshooting
|
Price detail
Introduction
This service begins with the preparation of plasmid DNA from a bacterial culture. One or more sequences can be generated using any primer that anneals within the plasmid. Most commercially available plasmids contain universal priming sites. The facility provides the following universal primers at no charge for your sequencing reactions:
- T7: TAATACGACTCACTATAGGG
- T3: AATTAACCCTCACTAAAGGG
- SP6: ATTTAGGTGACACTATAG
- M13: CGCCAGGGTTTTCCCAGTCACGAC
- M13R: TCACACAGGAAACAGCTATGAC
- M13(-21): TGTAAAACGACGGCCAGT
- T7term: TATGCTAGTTATTGCTCAG
- BGHrev: TAGAAGGCACAGTCGAGGC
- GL2: CTTTATGTTTTTGGCGTCTTCCA
- RV3: CTAGCAAAATAGGCTGTCCC
Submitted cultures must be spun down into a bacterial pellet and the culture media removed. Multiple sequences generated from a single plasmid or sequencing of low copy number plasmids will require larger bacterial cultures.
Sample preparation
Grow the bacterial cultures to saturation in 1 to 5mL of media with the appropriate selective agent for the plasmid.
Pellet the bacteria into a 1.5mL tube, doing multiple spin cycles if necessary.
If you are using your own primers, submit each one in a well of an 8-tube strip at a concentration of 3.5uM.
You will need to submit at least 10ul of primer + 2ul for each sequence beyond the first to be done with the primer (6 bacterial pellets to be sequenced with the same primer will require the submission of at least 20ul of that primer).
Our automated protocol requires the use of plasticware (tubes, strips & 96-well plates) of uniform dimensions that we provide at no charge.
You can find the plasticware at any of our drop-off locations near the barcoding station.
The use of plasticware with improper dimension will delay the processing of your samples.
First timer's walkthrough
For low copy number plasmids, grow a 5mL culture using one of the more stable selective agents like Kanamycin or Chloramphenicol.
Avoid using Ampicillin for extended growth periods. Make sure the culture reaches full saturation by incubating for a full 24 hours.
For high copy number plasmids grow a 1mL culture overnight.
TEMPLATE:
Centrifuge 1mL of culture at a time in a 1.5mL tube at 10,000g for 1 minute then pour out the supernatant.
If your culture is larger than 1mL, repeat the process in the same tube until the entire culture has been spun down into a bacterial pellet.
PRIMER:
Make a 20uM stock of your primers. From this stock, make a 3.5uM working solution for sequencing purposes.
Submit 10ul+2ul for each sequence beyond the first to be performed with this primer into a single well of an 8-tube strip.
Submission process
• Use the username and password we provided you when you registered your account and log in to the system from any page of the website.
• Select the online submission form and choose the SEQUENCING submission type.
• The prompts will guide you through the process. You will need to have the following information to fill out the electronic form: name of submission, type of plasticware in which the samples will be submitted (tubes, strips, plates), names of samples and primers and how many of each you are submitting as well as which samples will receive facility provided universal primers (if any).
• Make sure to hit the ACCEPT button at the end of the process to complete your submission.
• You will receive an email with an invoice as a PDF attachment for your records.
• Proceed to the delivery of samples to one of our drop-off locations (CCHMC or GRI) and register them using the barcode scanner as indicated in the how to submit section.
Troubleshooting
-not enough plasmid yield
-multiple clones
-no priming site
-structure in the sequence or high GC content
-not enough primer
Pricing for service
-Academic: $15 for the first sequence, $10 for additional sequences from the same template
-Commercial: $20 for the first sequence, $15 for additional sequences from the same template
Academic pricing includes CCHMC, University of Cincinnati (including the GRI), other colleges and universities and governmental orginizations such as the US EPA.