Introduction
|
Sample preparation
|
First timer's walkthrough
Submission process
|
Troubleshooting
|
Price detail
Introduction
This service generates the sequence of a purified plasmid. You can use any primer that anneals within the plasmid to initiate the sequence. Most commercially available plasmids contain universal priming sites. The facility provides the following universal primers at no charge for your sequencing reactions:
- T7: TAATACGACTCACTATAGGG
- T3: AATTAACCCTCACTAAAGGG
- SP6: ATTTAGGTGACACTATAG
- M13: CGCCAGGGTTTTCCCAGTCACGAC
- M13R: TCACACAGGAAACAGCTATGAC
- M13(-21): TGTAAAACGACGGCCAGT
- T7term: TATGCTAGTTATTGCTCAG
- BGHrev: TAGAAGGCACAGTCGAGGC
- GL2: CTTTATGTTTTTGGCGTCTTCCA
- RV3: CTAGCAAAATAGGCTGTCCC
The plasmid must be purified from a cleared bacterial lysate without residual proteins, salts, phenol, or ethanol contaminants and must be resuspended in a buffer free of EDTA. This can be done using one of several methods:
- Silica matrix capture column (like Qiagen's QIAquick)
- Phenol/Choloform extraction followed by ethanol precipitation
- Silica coated magnetic beads purification (like Promega's Magnesil)
Sample preparation
For each sequence, prepare the template (purified plasmid) and the sequencing primer mixed together in a single tube (or single well of an 8-tube strip or 96-well plate).
Please note that if multiple sequences are to be generated from the same template you must submit that template multiple times.
You will need to provide 100 ng per kb of total plasmid size (an 800bp insert cloned into a 3.2kb pTOPO vector will require 400ng of plasmid to be submitted for sequencing) together with 7 pmol of the sequencing primer in a total volume of 12ul.
If you want to use one of the universal primers listed above the facility will add it for you. In this case, you would simply submit the plasmid in a total volume of 10ul.
Our automated protocol requires the use of plasticware (tubes, strips & 96-well plates) of uniform dimensions that we provide at no charge.
You can find the plasticware at any of our drop-off locations near the barcoding station.
The use of plasticware with improper dimensions will delay the processing of your samples.
First timer's walkthrough
Prepare your sequencing sample by mixing together in a single tube (or well) primer, template and water in a total of 12ul. Skip the primer addition step if you are using one of the facility provided universal primers.
TEMPLATE:
Prepare your plasmid from a bacterial pellet using the Qiagen Qiaquick Spin plasmid preparation kit. Quantify the amount of plasmid
in your extraction by reading the OD260 of the solution and multiply by 50, this gives a concentration in ng/ul. Use the appropriate amount to make the final quantity 100ng per kb of total construct size.
WATER:
Bring template mixture to a total of 10 ul with molecular biology grade water.
PRIMER:
Make a 20uM stock of your primers. From this stock, make a 3.5uM working solution for sequencing purposes. Use 2ul (7pmol)
in each sequencing reaction. If you need to convert from ng/ul concentrations to molar concentrations, you can use our Primer Concentration Calculator.
The final volume for samples submitted with custom primers is 12ul.
Submission process
• Use the username and password we provided you when you registered your account and log in to the system from any page of the website.
• Select the online submission form and choose the SEQUENCING submission type.
• The prompts will guide you through the process. You will need to have the following information to fill out the electronic form: name of submission, type of plasticware in which the samples will be submitted (tubes, strips, plates), names of samples and primers and how many of each you are submitting as well as which samples will receive facility provided universal primers (if any).
• Make sure to hit the ACCEPT button at the end of the process to complete your submission.
• You will receive an email with an invoice as a PDF attachment for your records.
• Proceed to the delivery of samples to one of our drop-off locations (CCHMC or GRI) and register them using the barcode scanner as indicated in the how to submit section.
Troubleshooting
-too little template
-multiple clones
-no priming site
-too much template or primer
-structure in the sequence or high GC content
Pricing for service
Academic: $10
Commercial: $15
Academic pricing includes CCHMC, University of Cincinnati (including the GRI), other colleges and universities and governmental orginizations such as the US EPA.